COMPARAISON DE L’ACTIVITE PROTEASIQUE DES SOUCHES DE Bacillus thuringiensis STRAINS
pdf

SELLAMI Sameh*, ABDELKEFI-MESRATI Lobna, TOUNSI Slim, KAIS Jamoussi

Centre de Biotechnologie de Sfax, Laboratoire de Protection et d’Amélioration

des Plantes Equipe des Biopesticides, Sfax, Tunisie

E-mail: Cette adresse e-mail est protégée contre les robots spammeurs. Vous devez activer le JavaScript pour la visualiser.

 

 

Résumé.- Au cours de ce travail, il est réalisé un criblage parmi 4 souches réceptrices de B. thuringiensis visant la souche la moins productrice en enzymes protéolytiques. Il est noté que l’activité protéolytique des sous espèces israelensis 14T et 4Q7 après 48h, est d’une valeur de 165.9 UI et de 138.08 UI, respectivement, alors que celle pour les sous espèces kurstaki HD1cryB et BUPM95 est de 95.36 UI et de 400.62 UI, respectivement. Ainsi, il est choisi les souches HD1cryB et 4Q7 comme cellules hôtes pour le plasmide pHT-Blue-vip3Aa16. La vérification de l’électroporation des souches recombinantes de B. thuringiensis est réalisée par amplification PCR puisqu’il est retrouvé une bande de 820 pb reconnue au niveau du gène vip3Aa16.La synthèse de la protéine Vip3Aa16 à partir des souches recombinantes HD1cryB (pHT-Blue-vip3Aa16) et 4Q7 (pHT-Blue-vip3Aa16) a démontré que les protéases qu’héberge HD1cryB n’ont pas influé le taux d’expression de la protéine Vip3Aa16. La souche HD1cryB de B. thuringiensis pourrait être une souche réceptrice très adéquate.

Mots clés: B. thuringiensis, protéases, expression.

 

COMPARISON OF THE PROTEOLYTIC ACTIVITIES

OF Bacillus thuringiensis STRAINS

Abstract.-During this work, a screening among 4 receiving host cells of B. thuringiensis was realized in order to distinguish the least producing proteolytic enzymes strain. We found that the proteolytic activity of the B. thuringiensis subspecies israelensis 14T and 4Q7 after 48 hours is about 165.9 IU and at 138.08 IU, respectively. While the B. thuringiensis subspecies kurstaki HD1cryB and the cured BUPM95 is about 95.36 IU and 400.62 IU, respectively. Therefore, HD1cryB and 4Q7 were chosen as hosts cells for the pHT-Blue-vip3Aa16 plasmid. The electroporation of B. thuringiensis strains was verified via the PCR amplification since a band of 820 pb corresponding to the vip3Aa16 gene was detected. The synthesis of the protein Vip3Aa16 from the recombinant strains HD1cryB (pHT-Blue-vip3Aa16) and 4Q7 (pHT-Blue-vip3Aa16) demonstrated that HD1cryB proteases did not affect the Vip3Aa16 expression rate. Thus, the B. thuringiensis HD1cryB could be a very suitable host strain.

Key words: B. thuringiensis, proteases, expression.

 

Introduction

Durant plusieurs décennies, la lutte aux insectes nuisibles s'est faite par le biais des pesticides chimiques. Récemment, les communautés scientifiques ont été sensibilisées aux graves conséquences qu'entraînait l’usage de ces produits dangereux tels que l’accumulation de substances chimiques dans les sols et les eaux [1]. De ce fait, une alternative plus viable pour l’environnement s’est recherchée, ainsi se fut l’apparition de B. thuringiensis; la bactérie la plus utilisée en tant que biopesticide dans le monde entier [2].

B. thuringiensis est un bâtonnet, Gram-positif, aérobie produisant lors de la phase de sporulation des inclusions parasporales contenant des cristaux protéiques ou -endotoxines, qui sont toxiques pour une variété d’insectes [3]. Pendant la phase végétative, B. thuringiensis secrète une autre classe de protéines insecticides, ce sont les protéines Vip (Vegetative Insecticidal Proteins) actifs sur plusieurs espèces d'insectes, parfois différents que ceux ciblés par les -endotoxines [4, 5].

A part les -endotoxines et les protéines Vip, B. thuringiensis synthétise également différents facteurs de virulence parmi lesquelles les chitinases, les protéases, les phospholipase C et les β-exotoxines [6]. La production des protéases par B. thuringiensis commence après la fin de la phase exponentielle et se poursuit durant la phase stationnaire. Ces enzymes sont thermostables et appartiennent essentiellement à la classe des métalloprotéases par rapport aux protéases alcalines et cystéiques. Par exemple, la sous-espèce tenebrionis et kurstaki produisent en majorité des métalloprotéases, alors que la sous-espèce israelensis produisent des protéases de nature alcaline [7]. La proportion de ces classes varie d'une sous-espèce à une autre. Il existe deux types de protéases : les protéases intracellulaires qui interviennent dans plusieurs processus cellulaires et métaboliques telles que la régulation du cycle cellulaire, la différenciation et la sporulation [8], et les protéases extracellulaires qui permettent à la bactérie d’hydrolyser les protéines dans les milieux de culture synthétiques ou complexes.

Les protéases produites par B. thuringiensis ont fait l'objet d'un nombre important de recherches depuis quelques années vu leurs importances dans l'industrie des enzymes, ainsi plusieurs optimisations ont été réalisées au niveau du procédé de production de B. thuringiensis et sa capacité à produire des enzymes protéolytiques. Au contraire, en biotechnologie, ces protéases présentent des limites puisqu’ils peuvent dégrader des protéines étrangères lors des expressions hétérologues [9].

Le présent projet de recherche vise à chercher parmi 4 souches de B. thuringiensis, la souche la moins productrice de protéases afin de l’utiliser comme souche hôte pour garantir une meilleure expression de la protéine insecticide Vip3Aa16.

 

1.- Matériel et Méthodes

1.1.- Souches Bactériennes, plasmides et Conditions de Culture

Les souches de B. thuringiensis HD1cryB et BUPM95 curée appartiennent à la sous espèce kurstaki et sont obtenues à partir du curage des souches sauvages HD1 et BUPM95, respectivement, alors que les souches 14T et 4Q7 de B. thuringiensis, sont classées sous la sous espèce israelensis [10, 11]. Toutes ces souches n’hébergent pas le gène vip3Aa16 sauf la souche de B. thuringiensis sous espèce kurstaki BUPM95 [vip3Aa16 (+)] utilisée comme contrôle positif.

Les souches de B. thuringiensis utilisées au cours de ce travail ont été cultivées dans le milieu LB et à 30°C [12]. La concentration de l’érythromycine utilisée pour la croissance des souches recombinantes de B. thuringiensis est de 50 µg/ml [9].

Le plasmide pHT-Blue-vip3Aa16 qui exprime la protéine Vip3Aa16 a été construit par MESRATI et al. (2005) [13].

 

1.2.- Cultures des souches de Bacillus thuringiensis : 

La cinétique de croissance des souches de B. thuringiensis HD1cryB, BUPM95 curée, 14T, 4Q7 et BUPM95 ont été réalisées. Brièvement, des cultures de 50 ml de milieu LB liquide ont été inoculées avec des précultures qui correspondent aux différentes souches de B. thuringiensis à une DO initiale de 0.15 [12]. Ces cultures ont été effectuées dans un shaker à 30°C et sous agitation de 200 rpm. Par la suite, des prélèvements ont été réalisés au cours du temps et la DO à 600 nm a été mesurée afin de déterminer la cinétique de croissance de différentes souches de B. thuringiensis.

 

1.3.- Dosage de l’activité protéasique des souches de Bacillus thuringiensis

La mesure de l'activité protéolytique a été réalisée selon KEMBHAVI et al. (1993) [14] en présence d’une solution de caséine à 1% préparée dans le de Tris-HCl (0.1 mM) et à pH 7. Au début, les échantillons ont été centrifugés à 10.000 rpm pendant 10 minutes. Les surnageants obtenus ont été dilués dans une solution de Tris–HCl (0.1 mM) et additionnées à la caséine. Le mélange est incubé par la suite pendant 20 min et à 60°C. L’arrêt de la réaction se fait suite à l’ajout de 3 ml d’une solution d’acide trichloracétique préparée à 5% pendant 30 min. Après la centrifugation pendant 15 min, le surnageant obtenu est mesuré à 280 nm. Pour chaque échantillon, on prépare un blanc avec de l’enzyme inactivée à 100°C pendant 5min. Toutes les mesures ont été réalisées en triplicata. Une unité internationale d'enzyme est définie comme étant la quantité d’enzyme nécessaire pour la libération de 1 µg de tyrosine de la caséine par minute (1).

E06020301
5 ml: Volume final de la dilution                      

F: Facteur de dilution

20 min: temps de la réaction

0.0055: coefficient d’extinction de la tyrosine

 

1.4.- Electroporation de la souche de B. thuringiensis HD1cryB

Une culture de 50 ml de LB liquide est inoculée par une préculture de la souche HD1cryB et 4Q7, séparément, puis incubée à 30°C et sous une agitation de 200 rpm jusqu’à atteindre une valeur de DO 600 nm comprise entre 0,4 et 0,6. Après une incubation de 10 min dans la glace, cette culture est centrifugée pendant 10 min à 4000 rpm et à 4°C. Le culot est récupéré dans le tampon d’électroporation (400 mM sucrose, 1 mM MgCl 2; 7 mM Tp phosphate-potassium; pH 8) puis incubé pendant 2 heures dans la glace. Les cellules compétentes sont mélangées, séparément, avec 1 µg d’ADN du vecteur recombinant pHT-Blue-vip3Aa16 dans une cuve d’électroporation (BIORAD) pré-refroidie, puis soumise au choc électrique en utilisant «Gene Pulser» de BIORAD [13]. Ensuite, la suspension est diluée dans 1,2 ml de LB et incubée pendant 1 h à 30°C sous une agitation de 200 rpm, puis étalée sur un milieu sélectif LB-Em et incubés pendant une nuit à 30°C [9].

 

1.5.- Extraction d’ADN plasmidique et Amplification par PCR

Après avoir préparé les précultures des clones recombinants HD1cryB (pHT-Blue-vip3Aa16) et 4Q7 (pHT-Blue-vip3Aa16), procéder à l’extraction des ADN par minilysat alcaline [12]. L’exactitude des clones recombinants a été réalisée par amplification PCR via les amorces V6 (TTCACTTGAATTCTACTTATTTCTT) et V8 (GCTCTCCTGCAGATATTCTT) qui amplifient une région de 820 pb.

 

1.6.- Concentration des protéines par précipitation au TCA

Des échantillons de 10 ml des cultures totales des souches recombinantes de B. thuringiensis HD1cryB (pHT-Blue-vip3Aa16) et 4Q7 (pHT-Blue-vip3Aa16) et de la culture sauvage BUPM95 utilisée comme contrôle positif ont été prélevés puis centrifugés 10 min à 5000 rpm et à 4°C dans des tubes Falcon [9]. Ensuite, les surnageants ont été récupérés dans 1 ml de TCA 100% et incubés 30 min dans la glace dans le but de précipiter les protéines. Par la suite, les surnageants ont été centrifugés 20 min à 7000 rpm et à 4°C. Sur les culots récupérés, il est ajouté 200 µl du tampon de dépôt des protéines (1X), puis quelques microlitres de NaOH (5N) pour la neutralisation. Les échantillons de protéines précipitées sont solubilisés puis chauffés 5 min à 100°C pour compléter la dénaturation des protéines.

 

1.7.- Analyse des échantillons par Western blot

Les échantillons de protéines précipitées sont migrés au niveau d’un gel SDS-PAGE dont le pourcentage est de 9% [15]. Après l’électrophorèse, le gel est transféré sur une membrane "Hybond C+" comprise entre 2 papiers Wathman imbibés avec le tampon de transfert pendant 1 heure et sous un champ électrique de 15 V. Après le transfert, la membrane est lavée au PBS 1×, saturée avec la solution de saturation (PBS 1×, 4 % lait écrémé) pendant 30 mn à température ambiante et sous agitation, puis incubée avec l’anticorps anti-Vip3Aa16 pendant 2 h sous agitation et à température ambiante. Ensuite, la membrane est lavée 3 fois pendant 15 min dans le tampon (PBS 1´, lait écrémé 4 %) et hybridée avec l’anticorps anti-IgG de lapin couplé à la peroxydase (Biorad) pendant 1 h. La révélation se fait avec le kit ECL+ selon les instructions du fournisseur (Amersham). Un film Kodak Biomax est exposé puis développé à l’obscurité [9].

 

2. -Résultats et discussion

2.1.- Détermination de l’activité protéolytique

La plupart des souches de B. thuringiensis produisent des protéases nécessaires pour la synthèse des protéines nécessaires pour leurs croissances [16]. Cependant, ces protéases peuvent dégrader entre autres les protéines qui s’expriment à partir des plasmides recombinants. En effet, lors des manipulations génétiques de la souche entomopathogène B. thuringiensis, on assiste souvent à l’expression homologue et hétérologue de différents gènes codant pour des protéines insecticides afin d’améliorer le pouvoir insecticide des souches réceptrices [17]. Il est fixé comme objectif au cours de ce travail d’exprimer la protéine Vip3Aa16 dans une souche réceptrice de B. thuringiensis qui exprime le moins de protéases afin d’obtenir une meilleure synthèse de Vip3Aa16. Pour se faire, nous avons commencé au début par la mesure de l’activité protéolytique de 4 souches de B. thuringiensis BUPM95 curée, HD1cryB, 14T, et 4Q7 qui n’hébergent pas le gène vip3Aa16 dans le but de choisir la souche la plus pauvre en protéases. La figure 1 montre que la souche BUPM95 curée qui est obtenue suite au curage plasmidique de la souche sauvage BUPM95, présente l’activité protéolytique la plus élevée de 400.62 UI après 48h et ceci par rapport à la souche contrôle BUPM95 présentant uniquement une valeur de 193.18 UI après 48h (fig. 1). Ce résultat est déjà confirmé par DRISS et al. qui a démontré que le curage plasmidique des souches sauvages de B. thuringiensis provoque l’augmentation de la synthèse des protéases [18]. Ceci suggère que la souche BUPM95 curée sera la souche la moins potentielle à être transformer. La figure 1 montre également que l’activité protéolytique de la souche 14T est de 165.9 UI après 48h. D’autre part, il est démontré que la souche HD1cryB présente l’activité protéolytique la plus basse de 95.36 UI après 48h, à son voisinage se trouve la souche 4Q7 avec une valeur de 138.08 UI après 48h. C’est pour cette raison qu’ils sont choisis ces deux souches comme cellules hôtes pour le plasmide pHT-Blue-vip3Aa16.

E06020302

3.2.- Synthèse de Vip3Aa16 à partir de HD1cryB et 4Q7

Afin de comparer la synthèse de la protéine Vip3Aa16 à partir du plasmide pHT-Blue-vip3Aa16, il est procédé à son transfert par électroporation aux souches HD1cryB et 4Q7. Ce transfert a été vérifié via des amplifications PCR en utilisant les amorces V6, V8 qui reconnaissent une région de 820 pb au niveau du gène vip3Aa16. La figure 3 montre la présence d’une amplification de 820 pb à partir de HD1cryB (pHT-Blue-vip3Aa16) et 4Q7 (pHT-Blue-vip3Aa16) par rapport au contrôle négatif qui ne présente aucune bande.

E06020303

Par la suite, les souches recombinantes ont été cultivées dans le milieu LB et la production de Vip3Aa16 dans le milieu de culture a été analysée après 12 h de culture. L’autoradiogramme de la figure 4 laisse apparaître que le taux d’expression de la protéine Vip3Aa16 à partir de HD1cryB (pHT-Blue-vip3Aa16), est très élevé et il est comparable à celui de la souche sauvage BUPM95. Ce résultat témoigne que la souche HD1cryB pourrait être une souche réceptrice très adéquate et que les protéases qu’elle héberge et n’influe pas sur l’expression des protéines hétérogènes. La figure 4 montre également que cette expression est meilleure que celle réalisée à partir de 4Q7 (pHT-Blue-vip3Aa16), ce qui corrobore avec le taux d’activité protéolytique puisque la souche 4Q7 héberge plus de protéases que HD1cryB.

E06020304

Dans ce même contexte, la souche HD1cryB a été également utilisée comme cellule hôte pour l’expression de plusieurs gènes de B. thuringiensis tels que l’expression du gène codant pour la protéine Cyt1Aa [19], Cry1Ac [20], et la bactériocine F4 [21].

Conclusion

Dans ce présent travail, nous avons réussi à avoir un taux d’expression très important de la protéine insecticide Vip3Aa16 via son expression chez la souche hôte B. thuringiensis sous espèce kurstaki HD1cryB qui se distingue d’une production limitée en protéases.

Remerciements

Ce travail a été supporté financièrement par le Ministère de l’Enseignement Supérieur et de la Recherche Scientifique, Tunisie.

Références bibliographiques

[1].- Rice P. J., Arthur E. L., Barefoot A. C., 2007.- Advances in Pesticide Environmental Fate and Exposure Assessments. Journal of Agricultral and Food Chemistry., 55: 5367-5376.

[2].- Ongena M., Jacques P., 2008.- Bacillus lipopeptides: versatile weapons for plant disease biocontrol.Trends Microbiol., 16: 115-125.

[ 3].- Schnepf E., Crickmore N., Van Rie J., Lereclus D., Baum J., Feitelson J., Zeigler D. R., Dan D. H., 1998.- Bacillus thuringiensis and its pesticidal crystal proteins. Microbiology and Molecular Biology Reviews., 62: 775-806.

[4].- Estruch J. J., Warren G. W., Mullins M. A., Nye G. J., Craig J. A., Koziel M. G., 1996.- Vip3A, a novel Bacillus thuringiensis vegetative insecticidal protein with a wide spectrum of activities against lepidopteran insects. Proceedings of the National Academy of Sciences, 93: 5389-5394.

[5].- Doss V. A., Kumar K. A., Jayakumar R., Sekar V., 2002.- Cloning and expression of the vegetative insecticidal protein (vip3V) gene of Bacillus thuringiensis in Escherichia coli. Protein Expresion and purification, 26: 82-88.

[6].- Gohar M., Gilois N., Graveline R., Garreau C., Sanchis V., Lereclus D., 2005.- A comparative study of Bacillus cereus, Bacillus thuringiensis and Bacillus anthracis extracellular proteomes. Proteomics ., 5: 3696-3711.

[7].- Reddy S. T., Kumar N. S., Venkateswerlu G., 1998.- Comparative analysis of intracellular proteases in sporulated Bacillus thuringiensis strains. Biotechnology Letters, 20: 279-281.

[8].- Reddy Y. C., Venkateswerlu G., 2002.- Intracellular proteases of Bacillus thuringiensis subsp. kurstaki and a protease-deficient mutant Btk-q. Current Microbiology, 45: 405-409.

[9].- Sellami S., Jamoussi K., Dabbeche E., Jaoua S., 2011.- Increase of the Bacillus thuringiensis secreted toxicity against lepidopteron larvae by homologous expression of the vip3LB gene during sporulation stage.Current Microbiology, 63: 289-294.

[10].- Sellami S., Zghal T., Cherif M., Zalila-Kolsi I., Jaoua S., Jamoussi K., 2013.- Screening and identification of a Bacillus thuringiensis strain S1/4 with large and efficient insecticidal activities. Journal of Basic Microbiology, 52:1-10.

[11].- Diaz-Mendoza M., Bideshi D. K., Ortego F., Farinós G. P., Federici B. A., 2011.- The 20-kDa chaperone-like protein of Bacillus thuringiensis ssp. israelensis enhances yield, crystal size and solubility of Cry3A. Letters in Applied Microbiology, 54: 88-95.

[12].- Sambrook J., Frisch E.F., Maniatis T., 1989.- Molecular Cloning: A Laboratory Manual (2nd Ed.), Cold Spring Harbor Laboratory. Cold Spring Harbor: 1-34.

[13].- Mesrati A.L., 2005.- Etude moléculaire de VIP « Vegetative Insecticidal Protein»: le bioinsecticide de deuxième génération de Bacillus thuringiensis. Thèse de Doctorat (ENIS), Tunisie, 145 p.

[14].- Kembhavi A. A., Kulharni A., Pant A. A., 1993.- Salt tolerant and thermostable alkaline protease from Bacillus subtilis NCIM N°64. Applied Biochemistry and Biotechnology, 38: 83-92.

[15].- Laemmli U. K., 1970.- Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227: 680-685.

[16].- Oppert B., 1999. - Protease Interactions with Bacillus thuringiensis Insecticidal Toxins. Archives of Insect Biochemistry and Physiology, 42:1-12.

[17].- Chakroun M., Banyuls N., Bel Y., Escriche B., Ferré J., 2016.- Bacterial Vegetative Insecticidal Proteins (Vip) from Entomopathogenic Bacteria. Microbiology and Molecular Biology Reviews, 80: 329-350.

[18].- Driss F., Tounsi S., Jaoua S., 2011.- Elationship between plasmid loss and gene expression in Bacillus thuringiensis. Current Microbiology, 62: 1287-1293.

[19].- Elleuch J., Zghal R. Z., Jemaà M., Azzouz H., Tounsi S., Jaoua S., 2014.- New Bacillus thuringiensis toxin combinations for biological control of lepidopteran larvae. International Journal of Biological Macromolecules, 65:148-154.

[20].- Saadaoui I., Miled N., Jaoua S., 2010.- Evidence of the Involvement of E358, A498 and C571 of a New Cry1Ac δ-endotoxin of Bacillus thuringiensis in its high insecticidal activity against Ephestia kuehniella. Molecular Biotechnology, 45: 65-70.

[21].- Ben Fguira I., Fourati Z., Kamoun F., Tounsi S., Jaoua S., 2014.- Isolation of the Bacillus thuringiensis plasmid carrying Bacthuricin F4 coding genes and evidence of its conjugative transfer.The Journal of Infection in Developing Countries, 8: 727-732.